becksss3559 becksss3559
  • 04-05-2018
  • Mathematics
contestada

A cylinder has a radius of 10m and a 8m. What is the exact volume of the cylinder?

160 TT m3

80 TT m3

800 TT m3

18 TT m3

Respuesta :

jennifer102486 jennifer102486
  • 04-05-2018
The formula for the volume of a cylinder is πr^2*h. If you plug in the numbers of the radius and the height. π10^2*8=800π meters^3.
Answer Link

Otras preguntas

where are the three parts of an atom located
the reproductive system of a male mammal provides
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help me with this two step math problem! THANK YOU !!!!!!!!
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
why is the square root of a perfect square always rational
Write expression using the distributive property to find the product of 7 times 63
4.2meters= how many centimeter