alexxhenry5683 alexxhenry5683
  • 04-04-2022
  • Mathematics
contestada

( Pls help ASAP) Will give 20 points if you answer 2 questions))

Pls help ASAP Will give 20 points if you answer 2 questions class=
Pls help ASAP Will give 20 points if you answer 2 questions class=

Respuesta :

alexstevenwood alexstevenwood
  • 04-04-2022

Answer:

1. -3          2. y=-1

Step-by-step explanation:

Answer Link

Otras preguntas

Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
how do you know 8 thousandths is less than 1 hundredths
Please help me with this two step math problem! THANK YOU !!!!!!!!
why is the square root of a perfect square always rational
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before