sansyboy4948 sansyboy4948

02-11-2021
History

contestada

what would the incas do if they wanted a smaller tribe to join their empire?

Respuesta :

YogurtSlinger YogurtSlinger

02-11-2021

They would offer them power and riches if they agreed to join peacefully.

Answer Link

Otras preguntas

How does Alexandra’s universe of obligation differ from Atticus’s? ( From how to kill a mockingbird)

A binary search algorithm is written (as in the modules, for example) which searches a pre-sorted array for some user-defined value, clientData. If clientData i

A father who is 42 years old has a son and a daughter. The daughter is three times as old as the son. In 10 years, the sum of all their ages will be 100 years.

Help with questions A-C Brainliest Answer GIVEN

Subtract 9x^2-7x9x 2 −7x from -4x^2+6−4x 2 +6.

A recent study reported that 18- to 24-year-olds average 192 restaurant visits per year. Assume that the standard deviation for number of visits per year for th

Which is the best site for online Math and English

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Minneapolis minnesota and portland oregon have very similar latitudes. Latitude measures how far north or south place is which in turns affect the temperature.

An automaker promotion loan on a $20,000 vehicle. The downpayment is 20% are being financed for 48 months. The monthly payments will be $367.74. What will be th