asianiecet4 asianiecet4
  • 04-06-2021
  • Mathematics
contestada

What is the equation of the graph below?

What is the equation of the graph below class=

Respuesta :

gracecondra gracecondra
  • 04-06-2021
So by looking at the graph you can see it is cos since it dosent start at (0,0). Then since there is a phase shift of what looks like 90 to the left makes the equation y=cos(x+90)
Answer Link

Otras preguntas

i need help with #3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
four yardequal Blank feet
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
what is the most common type of vegetation throughout Latin America
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic