lishar913 lishar913

01-04-2021
Mathematics

contestada

Write the equation of the line through (3, 2) and (-4,5) in general form.

Respuesta :

26wallacen 26wallacen

01-04-2021

Answer:

So the required equation of the given line in the standard form is

Step-by-step explanation:

x-7y=-17

I hope this helps and i hope im correct

Answer Link

Otras preguntas

what would happen if a species is introduced into a new environment with no predators

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

1. This adheres to broad conventions and rules which determine the language and structure used, and relays or communicates non-interactively. A. Conversation B.

acceleration is the rate at which what happens?

Phil made 25% more cookies than Matt The cookies sold for $0.25 each. Matt and Phil made a total of $72.00 selling cookies. How many cookies did Matt make? How

WILL MARK BRAINLIEST Match the following terms with their descriptions

a load of watermelons is 57 kilograms heavier than a load of squash the Lotus cost weighs 34 kilograms how much is a load of watermelons weigh

I need help with this problem

can you help me?Answer the question please please pleasein the picturesolve each equation

What type of government does the U.S. have today. a b Monarchy Tyranny Oligarchy Democracy