Macydrussohay Macydrussohay

01-11-2016
History

contestada

What century did the scotts and irish introduce whiskey distilling?

Respuesta :

rose5406 rose5406

10-11-2016

It was in the 16th century I think

Answer Link

Otras preguntas

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp

Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.

What two molecules are produced by the light reactions and used to power the calvin cycle?

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Social disparity was one of the major causes of french revolution. Justify the statement

4/y+2 - 9/y-2 = 9/y^2-4

The element with the most stable nucleus and smallest mass per particle is

Both Ghandhi and king set which type of mood in their introduction

Which of the following is not a characteristic of African music? A. A wide range of indigenous instruments B. Strong harmonic structures C. Complex rhyt