marckuscalebmallari7 marckuscalebmallari7

01-09-2020
Chemistry

contestada

In a controlled experiment, a scientist is studying how long it takes parachutes of different sizes to fall to the ground. What is the experimental variable?

Respuesta :

bree39raim bree39raim

01-09-2020

The controlled variable would be the weight and time it'll take for the parachutes to land.
The uncontrolled variable is the wind and the amount of resistance.

Answer Link

Otras preguntas

Foster discusses some theories behind why sleep is so important. In his third theory, what examples does he give of how sleep helps us cognitively?

I Need help with this no links (you will get reported)

Which of the following pairs are corresponding angles? O 6 and 8 2 and 7 5 and 4 5 and 2

I (1. not like/ watch) _______________________ football.

x3 = 20 show your working plss

HELLPPPP MEEEEEEEEE!!!!!!!!!!!!!

Which phrase best describes nuclear fusion? ( 1 point) The process by which small nuclei combine into a larger nucleus A series of reactions in which particle

Help me pls, here you are.

When a group 1 element reacts it… a. Gains two electrons b. Loses two electrons c. Gains one electron d. Loses on electron

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'