youngdior
youngdior youngdior
  • 02-06-2020
  • Mathematics
contestada

Please give me the answer

Please give me the answer class=

Respuesta :

mwgaber13
mwgaber13 mwgaber13
  • 02-06-2020

Answer:

5.3

Step-by-step explanation:

Answer Link

Otras preguntas

1. Lisa drives her car 46 km south and then 13 km east. How far is she from her starting point? Show work
i need help plsss help me with this
A bookstore has 45 copies of a bestseller available on Saturday morning. Twenty-one customers purchase the book that day. On Monday, a shipment of 25 books arri
Why do parents tell us to wear what they what and not except what we want to wear?
The land east of the Appalachian Mountains was acquired as a result of the Civil War is true or false?
HELP HELP HELP HELP If your reflective essay is unclear about the timeline for what happened to you, what should you do to fix the problem?Add phrases and claus
What step should you take first when drawing a conclusion? A. First, you should consider all the facts and anything you know about them. B. First, you should
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
PLS HELP:( Find the volume of this figure.
How is the length of the image of a line segment under a dilation related to the length of its pre-image?