johnsontamira3p8q0dh johnsontamira3p8q0dh
  • 02-07-2018
  • History
contestada

warming climate 12,000 to 10,000 years ago impact the paleo indians living in the americans at the time

Respuesta :

Lizard2343
Lizard2343 Lizard2343
  • 02-07-2018
a. Paleo Indians went to war with each other on a large scale due to scarce water resources
b.paleo Indians rely less on hunting big animals and more on fishing and gathering food
c.paleo Indians faced food shortages that resulted in the lower population
d.paleo Indians lost land to risin sea levels
Answer Link

Otras preguntas

Is 5/7 greater than 4/6
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How much money, in dollars, does one mole of nickels represent?
How many times does four go into 153 ? What Is the remainder ?
4.2meters= how many centimeter
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
why did russia have revolution in 1917?